Mature sequence rlcv-miR-rL1-18-5p

Accession numberMIMAT0019186
IDrlcv-miR-rL1-18-5p
Previous IDsrlcv-mir-rL1-18-5p
Stem-Loop rlcv-mir-rL1-18
Sequence
uagaugauugggggcggcguauc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19889779 "A global analysis of evolutionary conservation among known and predicted gammaherpesvirus microRNAs" Walz N, Christalla T, Tessmer U, Grundhoff A J Virol. 84:716-728(2010).
2
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
3
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).