Mature sequence bfl-miR-216-3p

Accession numberMIMAT0019150
IDbfl-miR-216-3p
Previous IDsbfl-miR-216*
Stem-Loop bfl-mir-216
Sequence
cacggugcaagcugggaucgcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).