Mature sequence tca-miR-282-3p

Accession numberMIMAT0019126
IDtca-miR-282-3p
Stem-Loop tca-mir-282
Sequence
acauagccugauugaggcuaa
Get sequence
Deep sequencing reads, experiments
Database links
QuickGO function

References

1
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).