Mature sequence hsa-miR-4453

Accession numberMIMAT0018975
IDhsa-miR-4453
Stem-Loop hsa-mir-4453
Sequence
gagcuuggucuguagcgguu
Get sequence
Deep sequencing21 reads, 17 experiments
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).