Mature sequence hsa-miR-4445-3p

Accession numberMIMAT0018964
IDhsa-miR-4445-3p
Previous IDshsa-miR-4445*
Stem-Loop hsa-mir-4445
Sequence
cacggcaaaagaaacaaucca
Get sequence
Deep sequencing7 reads, 4 experiments
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).