Mature sequence hsa-miR-548ae-3p

Accession numberMIMAT0018954
IDhsa-miR-548ae-3p
Previous IDshsa-miR-548ae
Stem-Loop hsa-mir-548ae-1 hsa-mir-548ae-2
Sequence
caaaaacugcaauuacuuuca
Get sequence
Deep sequencing7942 reads, 103 experiments
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).