Mature sequence tca-miR-3811a-3p

Accession numberMIMAT0018645
IDtca-miR-3811a-3p
Stem-Loop tca-mir-3811a-2 tca-mir-3811a-4 tca-mir-3811a-3 tca-mir-3811a-5 tca-mir-3811a-1
Sequence
uauguacaaccgugaguggagacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).