Mature sequence hsa-miR-374c-5p

Accession numberMIMAT0018443
IDhsa-miR-374c-5p
Previous IDshsa-miR-374c
Stem-Loop hsa-mir-374c
Sequence
auaauacaaccugcuaagugcu
Get sequence
Deep sequencing6567 reads, 144 experiments
Database links
Predicted targets
QuickGO function

References

1