Mature sequence ngi-miR-281

Accession numberMIMAT0018388
IDngi-miR-281
Stem-Loop ngi-mir-281
Sequence
gucauggacuugcucucuuug
Get sequence
Deep sequencing reads, experiments

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).