Mature sequence far-miR166

Accession numberMIMAT0018375
IDfar-miR166
Stem-Loop far-MIR166
Sequence
ccggaccaggcuucaucccag
Get sequence
Deep sequencing reads, experiments

References

1