Mature sequence hsa-miR-3942-5p

Accession numberMIMAT0018358
IDhsa-miR-3942-5p
Previous IDshsa-miR-3942
Stem-Loop hsa-mir-3942
Sequence
aagcaauacuguuaccugaaau
Get sequence
Deep sequencing165 reads, 46 experiments
Predicted targets

References

1
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).