Mature sequence hsa-miR-3937

Accession numberMIMAT0018352
IDhsa-miR-3937
Stem-Loop hsa-mir-3937
Sequence
acaggcggcuguagcaauggggg
Get sequence
Deep sequencing53 reads, 4 experiments
Predicted targets

References

1