Mature sequence gma-miR4414a-5p

Accession numberMIMAT0018342
IDgma-miR4414a-5p
Previous IDsgma-miR4414
Stem-Loop gma-MIR4414a
Sequence
agcugcugacucguuggcuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
3