Mature sequence gma-miR4409

Accession numberMIMAT0018328
IDgma-miR4409
Stem-Loop gma-MIR4409
Sequence
uaacaaguggguuuguugacug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).