Mature sequence gma-miR4407

Accession numberMIMAT0018326
IDgma-miR4407
Stem-Loop gma-MIR4407
Sequence
cagaggaagcagcacuuguacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).