Mature sequence gma-miR4388

Accession numberMIMAT0018300
IDgma-miR4388
Stem-Loop gma-MIR4388
Sequence
aaucuuagggaccaaauugacagc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).