Mature sequence gma-miR1520k

Accession numberMIMAT0018291
IDgma-miR1520k
Stem-Loop gma-MIR1520k
Sequence
aaucagaacaugacacaugacagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).