Mature sequence gma-miR4368b

Accession numberMIMAT0018269
IDgma-miR4368b
Stem-Loop gma-MIR4368b
Sequence
aaggacgguacuuacguaagcaac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).