Mature sequence gma-miR4366

Accession numberMIMAT0018265
IDgma-miR4366
Stem-Loop gma-MIR4366
Sequence
cuacuuaguagagauuuguugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2