Mature sequence gma-miR4380a

Accession numberMIMAT0018261
IDgma-miR4380a
Stem-Loop gma-MIR4380a
Sequence
cggauuguugauccguaugugcau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).