Mature sequence gma-miR4361

Accession numberMIMAT0018256
IDgma-miR4361
Stem-Loop gma-MIR4361
Sequence
ccggaagagacuuacggaucaacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).