Mature sequence gma-miR1520h

Accession numberMIMAT0018255
IDgma-miR1520h
Stem-Loop gma-MIR1520h
Sequence
aacguccaaucagaacgugacaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).