Mature sequence gma-miR4357

Accession numberMIMAT0018249
IDgma-miR4357
Stem-Loop gma-MIR4357
Sequence
cagucgugugauuguacgguucau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).