Mature sequence gma-miR1520g

Accession numberMIMAT0018245
IDgma-miR1520g
Stem-Loop gma-MIR1520g
Sequence
caaucagaacaugacacgugacaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).