Mature sequence hsa-miR-676-5p

Accession numberMIMAT0018203
IDhsa-miR-676-5p
Previous IDshsa-miR-676*
Stem-Loop hsa-mir-676
Sequence
ucuucaaccucaggacuugca
Get sequence
Deep sequencing156 reads, 52 experiments
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
3
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).