Mature sequence hsa-miR-3919

Accession numberMIMAT0018193
IDhsa-miR-3919
Stem-Loop hsa-mir-3919
Sequence
gcagagaacaaaggacucagu
Get sequence
Deep sequencing32 reads, 21 experiments
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).