Mature sequence hsa-miR-3916

Accession numberMIMAT0018190
IDhsa-miR-3916
Stem-Loop hsa-mir-3916
Sequence
aagaggaagaaauggcugguucucag
Get sequence
Deep sequencing532 reads, 91 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).