Mature sequence mghv-miR-M1-12-3p

Accession numberMIMAT0018171
IDmghv-miR-M1-12-3p
Previous IDsmghv-miR-M1-12
Stem-Loop mghv-mir-M1-12
Sequence
uuuggugugggaguccuaccccuuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20660200 "Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts" Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW J Virol. 84:10344-10353(2010).
2
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).