Mature sequence pab-miR166b

Accession numberMIMAT0018149
IDpab-miR166b
Stem-Loop pab-MIR166b
Sequence
ucggaccaggcuucauuccuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20561211 "MicroRNAs, the epigenetic memory and climatic adaptation in Norway spruce" Yakovlev IA, Fossdal CG, Johnsen O New Phytol. 187:1154-1169(2010).