Mature sequence hsa-miR-3685

Accession numberMIMAT0018113
IDhsa-miR-3685
Stem-Loop hsa-mir-3685
Sequence
uuuccuacccuaccugaagacu
Get sequence
Deep sequencing56 reads, 16 experiments
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).