Mature sequence hsa-miR-3678-3p

Accession numberMIMAT0018103
IDhsa-miR-3678-3p
Stem-Loop hsa-mir-3678
Sequence
cugcagaguuuguacggaccgg
Get sequence
Deep sequencing77 reads, 15 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).