Mature sequence hsa-miR-3668

Accession numberMIMAT0018091
IDhsa-miR-3668
Stem-Loop hsa-mir-3668
Sequence
aauguagagauugaucaaaau
Get sequence
Deep sequencing7 reads, 5 experiments
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).