Mature sequence hsa-miR-3666

Accession numberMIMAT0018088
IDhsa-miR-3666
Stem-Loop hsa-mir-3666
Sequence
cagugcaaguguagaugccga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:20559549 "Large-scale expression analysis reveals distinct microRNA profiles at different stages of human neurodevelopment" Smith B, Treadwell J, Zhang D, Ly D, McKinnell I, Walker PR, Sikorska M PLoS One. 5:e11109(2010).