Mature sequence hsa-miR-3622b-3p

Accession numberMIMAT0018006
IDhsa-miR-3622b-3p
Stem-Loop hsa-mir-3622b
Sequence
ucaccugagcucccgugccug
Get sequence
Deep sequencing57 reads, 31 experiments
Predicted targets

References

1