Mature sequence hsa-miR-3622b-5p

Accession numberMIMAT0018005
IDhsa-miR-3622b-5p
Stem-Loop hsa-mir-3622b
Sequence
aggcaugggaggucagguga
Get sequence
Deep sequencing18 reads, 14 experiments
Predicted targets

References

1