Mature sequence hsa-miR-3618

Accession numberMIMAT0017998
IDhsa-miR-3618
Stem-Loop hsa-mir-3618
Sequence
ugucuacauuaaugaaaagagc
Get sequence
Deep sequencing33 reads, 15 experiments
Predicted targets

References

1