Mature sequence hsa-miR-3613-3p

Accession numberMIMAT0017991
IDhsa-miR-3613-3p
Stem-Loop hsa-mir-3613
Sequence
acaaaaaaaaaagcccaacccuuc
Get sequence
Deep sequencing3251 reads, 148 experiments
Database links
Predicted targets
QuickGO function

References

1