Mature sequence hsa-miR-3613-5p

Accession numberMIMAT0017990
IDhsa-miR-3613-5p
Stem-Loop hsa-mir-3613
Sequence
uguuguacuuuuuuuuuuguuc
Get sequence
Deep sequencing141419 reads, 150 experiments
Database links
Predicted targets
QuickGO function

References

1