Mature sequence hsa-miR-3610

Accession numberMIMAT0017987
IDhsa-miR-3610
Stem-Loop hsa-mir-3610
Sequence
gaaucggaaaggaggcgccg
Get sequence
Deep sequencing193 reads, 56 experiments
Database links
Predicted targets
QuickGO function

References

1