Mature sequence hsa-miR-3607-3p

Accession numberMIMAT0017985
IDhsa-miR-3607-3p
Stem-Loop hsa-mir-3607
Sequence
acuguaaacgcuuucugaug
Get sequence
Deep sequencing reads, experiments
Database links
Predicted targets
QuickGO function

References

1