Mature sequence ssc-miR-4335

Accession numberMIMAT0017968
IDssc-miR-4335
Stem-Loop ssc-mir-4335
Sequence
gugcccagcgcugcagggca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).