Mature sequence aly-miR4223

Accession numberMIMAT0017911
IDaly-miR4223
Stem-Loop aly-MIR4223
Sequence
auggaauuugauaaauaaacac
Get sequence
Deep sequencing5 reads, 1 experiments

References

1