Mature sequence rno-miR-219b

Accession numberMIMAT0017882
IDrno-miR-219b
Stem-Loop rno-mir-219b
Sequence
agauguccagccacaauucucg
Get sequence
Deep sequencing296 reads, 160 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).