Mature sequence rno-miR-3579

Accession numberMIMAT0017867
IDrno-miR-3579
Stem-Loop rno-mir-3579
Sequence
gcgcauguucuauggucaacca
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).