Mature sequence rno-miR-1188-5p

Accession numberMIMAT0017854
IDrno-miR-1188-5p
Stem-Loop rno-mir-1188
Sequence
uggugugagguugggccagga
Get sequence
Deep sequencing414 reads, 88 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).