Mature sequence rno-miR-208b-5p

Accession numberMIMAT0017844
IDrno-miR-208b-5p
Stem-Loop rno-mir-208b
Sequence
aagcuuuuugcucgcguuau
Get sequence
Deep sequencing350 reads, 39 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).