Mature sequence rno-miR-3544

Accession numberMIMAT0017798
IDrno-miR-3544
Stem-Loop rno-mir-3544
Sequence
aacuccugcaugacgccguuccc
Get sequence
Deep sequencing133 reads, 52 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).