Mature sequence aly-miR774b-5p

Accession numberMIMAT0017699
IDaly-miR774b-5p
Previous IDsaly-miR774b
Stem-Loop aly-MIR774b
Sequence
ugagaugaagauuuggaugac
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).