Mature sequence aly-miR861-3p

Accession numberMIMAT0017652
IDaly-miR861-3p
Stem-Loop aly-MIR861
Sequence
gauggauauaucuucaagaac
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).