Mature sequence aly-miR827-3p

Accession numberMIMAT0017608
IDaly-miR827-3p
Previous IDsaly-miR827
Stem-Loop aly-MIR827
Sequence
uuagaugaccaucaacaaacg
Get sequence
Deep sequencing16 reads, 1 experiments
Database links
QuickGO function

References

1
2
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).